Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circCDYL | |||
Gene | CDYL | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Cardiovascular Disease | ICD-10 | Cardiovascular disease, unspecified (I51.6) |
DBLink | Link to database | PMID | 28676412 |
Experimental Method | |||
Sample Type | Tissues and hiPSC Cell lines | Comparison | hiPSC cells with adrenergic stimulation and 8 failing myocardium vs non failing controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward ACAGGCTTAGCTGTTAACGGGA ReverseGTCATAGCCTTTCCACCGAACC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Siede, D, Rapti, K, Gorska, AA, Katus, HA, Altmuller, J, Boeckel, JN, Meder, B, Maack, C, Volkers, M, Muller, OJ, Backs, J, Dieterich, C (2017). Identification of circular RNAs with host gene-independent expression in human model systems for cardiac differentiation and disease. J. Mol. Cell. Cardiol., 109:48-56. |